                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -3.89 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-18.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCGCGGATGAATCGTTCAGAAACTCCAGCTAAGTCTGCGAGCTCTCCTTGTCTAAG
GCCTAGCTCTTTGCGTCCGTTGAGCAGCGCCATTCCGATTTCTTCTGCGTTCATGTGC
ATcctttggatccaactttcggcatgatcgtgccgttctttgcagtatacatccgtttcggagcctaaacaaggaaaaccggcaagatcgtgccgagtt
tccggtttggatggggtttgggatgttaatgggagaggatcggcgtgatcgtgccggtttttcttgcgttggtagtcttggggctATG

    NCgl1188 Gene: NCgl1188     GI: 19552457     BI number: NCgl1188     GOG: COG3153     Description: predicted acetyltransferas at g  c       at a  g      g  g at        gt cg        gt gc        ta gc        ta cg       t  t c  a      g  g a  g      g  g at       g  g at       g  a at       t  g       at gc       a  a      g  c gc       g  |      t  g a  g      g  |       gt a  |       tg        cg cg        tg        gc at        ta        gc at        gt        cg at        gc        tg tg        cg        at cg        cg        gt                         tttcttgcgttggtagtcttggggctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3153 Predicted acetyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -8.20 kcal/mol Antiterminator: Size=42 nt.     Delta G= -5.34 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G= -6.29 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATCGCGGATGAATCGTTCAGAAACTCCAGCTAAGTCTGCGAGCTCTCCTTGTCTAAG GCCTAGCTCTTTGCGTCCGTTGAGCAGCGCCATTCCGATTTCTTCTGCGTTCATGTGC ATcctttggatccaactttcggcatgatcgtgccgttctttgcagtatacatccgtttcggagcctaaacaaggaaaaccggcaagatcgtgccgagtt tccggtttggatggggtttgggatgttaatgggagaggatcggcgtgatcgtgccggtttttcttgcgttggtagtcttggggctATG     NCgl1188 Gene: NCgl1188     GI: 19552457     BI number: NCgl1188     GOG: COG3153     Description: predicted acetyltransferas GA C  T C  T T  T T  C        t A  T      t  t C  T       cg C  C       cg GT        Ta CG        At GC       C  c A  |       Gc CG        Ta GT       G  a AT       T  c GC       A  t T  |      C  t TA       T  t GT       T  c       at CG       G  g      g  c C  |       Cg        tg T  |       Gc        at GT        Ta        cg CG       |  t       gc GC        Cg        gc TA        Ta        cg                         ttctttgcagtatacatccgtttcggagcctaaacaaggaaaaccggcaagatcgtgccgagtttccggtttggatggggtttgggatgttaatgggagaggatcggcgtgatcgtgccggtttttcttgcgttggtagtcttggggctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3153 Predicted acetyltransferase ... can be seen here     ..................................................................................................................