                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-31.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAACCTGGCTGGTCTCGCGGGCATGTCCCTGCCTTCCGGCTTGGCATCAGATACTGG
TCTGCCTGTTGGTTTGCAGCTGATGGCTCCTGCTTTCCAGGACGATCGTCTCTACCGC
GTCGGCGCTGCTTTTGAAGCTGGACGCAAGTAGgttctaaaccctttttaagaaattggctgccctcgcatgactg
tgcgcgggcggccaattttttcttttgtgggggtgcctcttacgcatttcctgaatttttgttaggcttgcctaggtcagttaaagatatatcgataaga
ggttttccATG

    NCgl1200 Gene: NCgl1200     GI: 19552469     BI number: NCgl1200     GOG: COG2375     Description: siderophore-interacting protei ac g  t tg at cg gc cg        tc t  c      t  t cg       t  t cg       t  t cg       t  t gc        tg         t tg        at       c  t cg       |  g      t  a gc       a  g      c  c gc        cg        cg ta        cg        gc ta       g  g       ta at        gt        gt at        cg       g  t at        gc       g  t gt        gc        gc at        gt        gc                         tgaatttttgttaggcttgcctaggtcagttaaagatatatcgataagaggttttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2375 Siderophore-interacting protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:80 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G=-21.30 kcal/mol                                                                         Nomenclature/Definitions TGAACCTGGCTGGTCTCGCGGGCATGTCCCTGCCTTCCGGCTTGGCATCAGATACTGG TCTGCCTGTTGGTTTGCAGCTGATGGCTCCTGCTTTCCAGGACGATCGTCTCTACCGC GTCGGCGCTGCTTTTGAAGCTGGACGCAAGTAGgttctaaaccctttttaagaaattggctgccctcgcatgactg tgcgcgggcggccaattttttcttttgtgggggtgcctcttacgcatttcctgaatttttgttaggcttgcctaggtcagttaaagatatatcgataaga ggttttccATG     NCgl1200 Gene: NCgl1200     GI: 19552469     BI number: NCgl1200     GOG: COG2375     Description: siderophore-interacting protei           ac          g  t           tg           at           cg           gc           cg          t  c           cg           cg           cg           gc           tg           cg           gc             caattttttcttttgtgggggtgcctcttacgcatttcctgaatttttgttaggcttgcctaggtcagttaaagatatatcgataagaggttttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2375 Siderophore-interacting protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-27.10 kcal/mol Antiterminator: Size=71 nt.     Delta G=-16.80 kcal/mol Anti-antiterminator:   Size=40 nt.     Delta G=-12.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGAACCTGGCTGGTCTCGCGGGCATGTCCCTGCCTTCCGGCTTGGCATCAGATACTGG TCTGCCTGTTGGTTTGCAGCTGATGGCTCCTGCTTTCCAGGACGATCGTCTCTACCGC GTCGGCGCTGCTTTTGAAGCTGGACGCAAGTAGgttctaaaccctttttaagaaattggctgccctcgcatgactg tgcgcgggcggccaattttttcttttgtgggggtgcctcttacgcatttcctgaatttttgttaggcttgcctaggtcagttaaagatatatcgataaga ggttttccATG     NCgl1200 Gene: NCgl1200     GI: 19552469     BI number: NCgl1200     GOG: COG2375     Description: siderophore-interacting protei            aa           a  t            gt            ag           |  g           |  c           |  t           |  g           |  c           |  c           |  c           |  t           |  c           |  g            ac            ta           t  t           t  g            ta            tc            ct TT        c T  T       c C  G       a G  A       a        ac TA        a       g  t CG       |         tg GC       |         at C  T      t         cg G  G       c        gc G  |       t        cg CG        t       t  c TA        g        cg GC       |         cg CG        G        cg GC        A        gc |  A       T        tg C  A      G         cg CG       A         gc AT        A        gc TA        C        ta CG        G        ta                         ttttttcttttgtgggggtgcctcttacgcatttcctgaatttttgttaggcttgcctaggtcagttaaagatatatcgataagaggttttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2375 Siderophore-interacting protein ... can be seen here     ..................................................................................................................