Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:159 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.61 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGCCGCCTGACGTGAGAGTAGCAATTCGCATGTCTTCCATattaaacccatcacaacacccgcgccg
gaacaatcacccaaaaataagagaatcacaggggttgacaggccaaaaaactgtctctgaccatcttatttaatcgccagagctgcagtttcattaacaa
atcgacattgtccgagcgggcatgtggtgtgctgcacaatttttggtcggacacatttttgcccccattgggttgtcggatcagatcaagaaaacccccg
cggaaaaattttgtctctagactggctcaccATG

    NCgl1201


Gene: NCgl1201     GI: 19552470     BI number: NCgl1201     GOG: NOG15259     Description: hypothetical membrane protei


  g
a  a
a  g
t  a
a  a
a  t
a  c
a  a
a  c        a
c  a      a  a
 cg       c  a
 cg       c  a
a  |      g  a
 cg        gc
 tg        at
 at        cg
 at        at
 cg        gc
a  a      |  t
a  c      |  c
g  a      |  t
g  |       tg
 cg        ta
 cg        gc
 gc        gc
            atcttatttaatcgccagagctgcagtttcattaacaaatcgacattgtccgagcgggcatgtggtgtgctgcacaatttttggtcggacacatttttgcccccattgggttgtcggatcagatcaagaaaacccccgcggaaaaattttgtctctagactggctcaccATG


    ..................................................................................................................