                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-21.20 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.76 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAAGTTCCATTCGAACGCTGGGTTACTGCCCAGGCAATGTTTGGATAGtttttcgggctttta
tcaacagccaataacagctctttcgcccattgaggtggaggggctgttttttcatgccgtaaggaaagtgcaagtaagtgaaatcaagtggcctagatcc
attgacacttagactgtgacctaggcttgactttcgtgggggagtggggataagttcatcttaaacacaatgcaatcgattgcatttacgttccttatcc
cacaataggggtaccttccagaaagttggtgaggagATG

    NCgl1203 --- NCgl1204 --- NCgl1205 --- NCgl1206 --- NCgl1207 Gene: NCgl1203     GI: 19552472     BI number: NCgl1203     GOG: COG1609     Description: transcriptional regulator Gene: NCgl1204     GI: 19552473     BI number: NCgl1204     GOG: COG1129     Description: ABC-type transporter, duplicated ATPase component Gene: NCgl1205     GI: 19552474     BI number: NCgl1205     GOG: COG1172     Description: ABC-type transporter, permease component Gene: NCgl1206     GI: 19552475     BI number: NCgl1206     GOG: COG1879     Description: ABC-type transporter, periplasmic component Gene: NCgl1207     GI: 19552476     BI number: NCgl1207     GOG: COG1869     Description: uncharacterized components of ribose/xylose transport syste   A A  T       ta CG       a  a GT       a  c GT       c  a AT        cg        tt CG        gc       a  g CG        at       c  a C  A      c  c       cg GT       a  t       cg TA       a  t       gt CG       c  t       cg At       t  c       tg |  t      a  |       ta T  t      t  |       tg T  t      t  |       cg Gt       t  |       tg Gc       t  |       cg G  g       cg        gc Tg        gc        at Cg        gc        cg Gc        gc        at                         tttttcatgccgtaaggaaagtgcaagtaagtgaaatcaagtggcctagatccattgacacttagactgtgacctaggcttgactttcgtgggggagtggggataagttcatcttaaacacaatgcaatcgattgcatttacgttccttatcccacaataggggtaccttccagaaagttggtgaggagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1609 Transcriptional regulators ... can be seen here [G] COG1129 ABC-type sugar transport system, ATPase component ... can be seen here [G] COG1172 Ribose/xylose/arabinose/galactoside ABC-type transport systems, permease components ... can be seen here [G] COG1879 ABC-type sugar transport system, periplasmic component ... can be seen here [G] COG1869 ABC-type ribose transport system, auxiliary component ... can be seen here     ..................................................................................................................