                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:211 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGCTTTTCGACGCCAGCTAGcccctttgttcacccaaaccggcgcttactgtgaattcatcattcacaatgggcgccggttt
tttctatttgggatcggtggtttgcgttttaggaggcgacttcagtagggaatcgggactttgttgactgaagtcgtgtgatgagaagttgagcgcgcga
agttgagggggagaagtcgcctattgggggttattttcgatgcccgatcacagtaatctcgaacaggttaggtaaggtttgcatactttatttttatcct
gaagggacgggcgccaATG

    NCgl1209 Gene: NCgl1209     GI: 19552478     BI number: NCgl1209     GOG: COG0614     Description: ABC-type transport system, periplasmic componen            ca           t  c           t  c aA        gc c  T       ta cG        ta         a gC        ta       c  t cG       |  c      t  c gC       c  c       ta gC        cg        at |  A       cg        at |  G      |  c       gc |  C       cg        ta |  T       Gc        gc g  A       At        ta c  G      T  t      c  a a  c      C  a       at gc        Gc        tg gc        At        tg gc       C  |       cg at        Cg        gc at        Gt        cg gt        Cg        gc                         cggttttttctatttgggatcggtggtttgcgttttaggaggcgacttcagtagggaatcgggactttgttgactgaagtcgtgtgatgagaagttgagcgcgcgaagttgagggggagaagtcgcctattgggggttattttcgatgcccgatcacagtaatctcgaacaggttaggtaaggtttgcatactttatttttatcctgaagggacgggcgccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here     ..................................................................................................................