                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=18 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCCGCGCCAGTAAGCACGCCTTCGATGACAGTGCCCACTACGGTGGAGGAGACCCCA
ACGATGGAATCTAACGTCGAAACGCAGCAGGAAACCTCAACCCCTGCAACCGCAACGC
CCCAGCGAGCCGACACCATCGAACCGACCGAGGAAGCCACGTCGCAGGAGGAAACGAC
TGCGTCGCAGACGCAGTCTCCAGCAGTGGAAGCACCAACCGCGGTCCAAGAGACAGTT
GCGCCGACGTCCACCCCTTAGgacgctgattacagacgtgtcccatttctttactactattggaaattATG

    NCgl1220 Gene: NCgl1220     GI: 19552489     BI number: NCgl1220     GOG: NOG17687     Description: hypothetical protei   A G  C A  A G  G AT AT CG C  C TG GC GC CG |  A GC CG C  | A  | A  |                  a C  |                t  c C  |                t  a A  |       CC       a  g C  |      C  T      g  a G  |      C  T      t  c A  |      A  A       cg AT        CG        gt GC        Cg        cg GC        Ta        at TA        Gc        gc GC        Cg        Gc                         catttctttactactattggaaattATG     ..................................................................................................................