Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-21.60 kcal/mol

                                                                        Nomenclature/Definitions

tgacacaccatgaccattattcgacttgtagtagtaaccgcgcggcgcctgccgtaacggccttccaagtcgtctcgtcaagcgccctcgacaacactca
ccacagtgttggaacgagggctttcttgttggttatgacccaagtagccaactttgcaacagacatctgtcgcactgcgtgcacacgcatccgcgtcgga
acaattttaaatgagggctttgtctttaggctgagttgaaatcggcttggcttggacgggtcctgtgaaaatccttatttagtaaaggagccagaaagtc
GTG

    NCgl1222 --- NCgl1223


Gene: NCgl1222     GI: 19552491     BI number: NCgl1222     GOG: COG0028     Description: thiamine pyrophosphate-requiring enzyme
Gene: NCgl1223     GI: 19552492     BI number: NCgl1223     GOG: COG0440     Description: acetolactate synthase, small subuni


          cc
         a  a
         c  c
          ta
          cg
          at
          cg
          at
          at
          cg
         |  g
         |  a
         a  a
          gc
          cg
          ta
          cg
          cg
          cg
          gc
            tttcttgttggttatgacccaagtagccaactttgcaacagacatctgtcgcactgcgtgcacacgcatccgcgtcggaacaattttaaatgagggctttgtctttaggctgagttgaaatcggcttggcttggacgggtcctgtgaaaatccttatttagtaaaggagccagaaagtcGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[EH] COG0028 Thiamine pyrophosphate-requiring enzymes [acetolactate synthase, pyruvate dehydrogenase (cytochrome), glyoxylate carboligase, phosphonopyruvate decarboxylase] ... can be seen here
[E] COG0440 Acetolactate synthase, small (regulatory) subunit ... can be seen here

    ..................................................................................................................