                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCACATTTGGCCGTCATCTGGAAAACAAATTCGACGGCGTTTCCATTAAGCGTTCA
ACAAACAGGGCAGCGGTCTTGGAAGGTGCGTCAGCATGGTTGAGTGGCGCTGTGGTGG
ATAAATACCCAGGTGGAGATCACTTTATTATCACCATTGCCGTGGAAGAGTGTGCTCA
CGACGAGGAGCAAAAGCCACTTCTTTACCACCGTGGCAGGCTTTTTCAGTGGCAAGAA
GATTAAttctccaccccttcattttcaataagctttcaataaggggagaagtgtgcttagctggggtcATG

    NCgl1232 --- NCgl1233 --- NCgl1234 Gene: NCgl1232     GI: 19552501     BI number: NCgl1232     GOG: COG1230     Description: Co/Zn/Cd efflux system component Gene: NCgl1233     GI: 19552502     BI number: NCgl1233     GOG: COG1479,COG3472     Description: hypothetical protein Gene: NCgl1234     GI: 19552503     BI number: NCgl1234     GOG: NOG29507     Description: hypothetical protei TA A  A G  A GT TA GC         T GC       T  G T  C      A  C G  A      C  C TG        CG CG        AT GT        CG        AC CG        TG       G  G |  G      A  A      C  A |  A      T  |      A  G |  G      T  |       CG |  A      A  |       TA GT        TA        CG GC        TG        GC TA        TA        TA GC        CG       G  A AT        AT       T  A GT        CG       G  A |  T      T  T      A  G |  A      A  G      G  | |  T       GC       A  | T  T       AT       A  | TA       G  |       GC GT        GC        GC GC        TA        TA TA        GC        GC                         TTCTTTACCACCGTGGCAGGCTTTTTCAGTGGCAAGAAGATTAAttctccaccccttcattttcaataagctttcaataaggggagaagtgtgcttagctggggtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1230 Co/Zn/Cd efflux system component ... can be seen here [S] COG1479 Uncharacterized conserved protein ... can be seen here [S] COG3472 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................