Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.60 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-10.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCAGCACGTTGATCAGGTTATGAAAAATGTTCCGAGCTCCCAGCGTTGCCAGGGCC
ACAAGGCAGAGCCTTCCAAGGGCTTCCTTTCCAAGCTTTTCGGCTAAgcatgccggatatggcca
atccttccgggggttggccgttttttgcttttcgacgcaaacccaccgccgcaggcaagagtttttcgtcgaaaagcgcagtgtttttagcaatcggaag
caattattgaatttaatagtcccggttatgcccgattgggcttcattttccggcattttcctttaaactcatctgctATG

    NCgl1255


Gene: NCgl1255     GI: 19552527     BI number: NCgl1255     GOG: COG0058     Description: glucan phosphorylas


  C
C  A
T  A
 TG
 CG
 CG
 GC
 AT
 GT
A  |
C  |
 GC
 GC
 AT
 AT         g
|  T      A  c
|  C      A  a       cc
C  C      T  t      t  g
A  A       Cg        tg
C  A       Gc        cg
 CG        Gc        cg
 GC        Cg        tg
 GT        Tg        at
 GT        Ta        at
 AT       |  t       cg
|  T      |  a       cg
|  C      T  t       gc
 CG        Tg        gc
 CG        Cg        tg
 GC        Gc        at
                        tttttgcttttcgacgcaaacccaccgccgcaggcaagagtttttcgtcgaaaagcgcagtgtttttagcaatcggaagcaattattgaatttaatagtcccggttatgcccgattgggcttcattttccggcattttcctttaaactcatctgctATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG0058 Glucan phosphorylase ... can be seen here

    ..................................................................................................................