                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=14 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTAGCGTACAAGGCTGCAAGTGCTCCGGCGAAGCGCTGCCACGGCACAGTTGGCGCA
GGAATTGTAGGGTTGGCCATTCCTTCAGCCCGCGCGGCAAAGCGCTTTTTCCGGGTTT
TGAAGGCAGCTGTAATCATTACTATGGAAATGAGAATCACTGCGGCAAAGAGCAAAAT
GATGAAGATCGTTTGTTGGCTCGACATagctgtttattttaaagtccctcccgagcccatgccggataaaacaaaacccg
agcgcctgccaacgcaaaatccagcctcacttaaggttattgcaccATG

    NCgl1278 Gene: NCgl1278     GI: 19552550     BI number: NCgl1278     GOG: COG0834     Description: ABC-type transporter, periplasmic componen GC G  C T  A T  T GT GC GC AT T  T GC TA T  G A  | A  | GC GC A  C CG GC        CA CG       G  A G  |      G  A GC        CG TG        GC TG        CG GC        GC             TTTTTCCGGGTTTTGAAGGCAGCTGTAATCATTACTATGGAAATGAGAATCACTGCGGCAAAGAGCAAAATGATGAAGATCGTTTGTTGGCTCGACATagctgtttattttaaagtccctcccgagcccatgccggataaaacaaaacccgagcgcctgccaacgcaaaatccagcctcacttaaggttattgcaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................