                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -4.65 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTGACACACCACTCAAGTTGCCTCGTTCAAGACGTGTGTAATAGTCCACGCTCACG
CCAGCCAACATGGCCACTTCTTCACGTCGAAGCCCCGGAACTCGCCTTTTGCCTTGGT
AAATAGGCAATCCGGCGTCTTTTGGAGTGAGACGATTGCGGCGCGCAGTGAGGAATTC
TCGAGTATCTGCGTGTACATCCATATCTTCAACATAGGCGTTGGGGCTGACTTTTAAA
CAGGTACCAGTAGTACCGGCATAAGCGATCACtgttgcgttttcttgctgccatcaaaaattagtcacATG

    NCgl1300 Gene: NCgl1300     GI: 19552568     BI number: NCgl1300     GOG: COG0477     Description: permease of the major facilitator superfamil   A C  A C  C G  A AT CG CG GC C  C A  |       GC C  |      A  C T  |      A  C C  |       GC G  |       CG C  |       TG A  |      G  A C  |      C  A       TA C  |      A  C      G  A TA       C  T      G  A GC       T  C      T  T AT       T  G       TA T  T      C  C       CG A  C      T  C       CG A  T      T  T       GC T  T      C  T       TA G  |      A  T       TA T  |      C  T      |  T GC        CG       T  C TA        GC       T  C GC        GC        CG CG       T  T       CG AT        AT        GC GC        CG        CG                         TCTTTTGGAGTGAGACGATTGCGGCGCGCAGTGAGGAATTCTCGAGTATCTGCGTGTACATCCATATCTTCAACATAGGCGTTGGGGCTGACTTTTAAACAGGTACCAGTAGTACCGGCATAAGCGATCACtgttgcgttttcttgctgccatcaaaaattagtcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................