Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.86 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -9.96 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCGTCCACATCCCACCAGTATCGGTTTGCTTGAGAGAACTGGCTCAAttggtggcttgaggt
tttcccattggtcccatcagtatcgtatgtgcccatttttgccattctatttgctctagctgcgcaaacggcgtactgtttattaggcgtgtcgttgcgt
catgtatcggtgtgttcatgtaggaaagcacattgagcctgaacgtgagatcaaaaccccgtctatacagggcatttgaaagatactgcatcctgtccat
tatctaatttcctatccatttcggagcaatttacatATG

    NCgl1304


Gene: NCgl1304     GI: 19552573     BI number: NCgl1304     GOG: COG0539     Description: ribosomal protein S


  c
c  c
 ta
 gt
 gc
 ta
 tg
 at
|  a
|  t
|  c
c  g       ct
c  t      t  a
c  a      t  t
t  t      a  t
t  g      c  t
t  t       cg
 tg        gc
 gc       t  t
 gc       t  c
a  |      t  t
 gc       t  a
 ta       t  g        a
|  t      a  c      a  c
|  t      c  t      a  g
|  t      c  |       cg
|  t       cg        gc
t  t       gc        cg
 cg        tg        gt
 gc        gc        ta
 gc        ta       c  |
 ta       a  a       gc
 gt        ta        at
 gt        gc        tg
                        tttattaggcgtgtcgttgcgtcatgtatcggtgtgttcatgtaggaaagcacattgagcctgaacgtgagatcaaaaccccgtctatacagggcatttgaaagatactgcatcctgtccattatctaatttcctatccatttcggagcaatttacatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0539 Ribosomal protein S1 ... can be seen here

    ..................................................................................................................