                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=75 nt.     Delta G=-17.12 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCGGCAATGCACGGACGTGGTCTGCGTGGCGGTGGGTGGTCAACACTTTGGTGATGG
TCACACCGGCATCTTCGGCTAATTTAAGTAGTGCAGCTGCGTCATCTGCAGCATCAAT
GAGTAAACCGTTGCCATTTGCGGCCAAAAGGTAGCAATTGTTGTCCATTTGGGACACG
GAAATATGGTGAAGAGTGAGCTCGTTAGTCATgtggttcagactagcggaaacaccttgttcgatgctatgttcga
aggtgtattttttgaagcgacaaaaatcgattttgaagggcagttgagcaTTG

    NCgl1322 Gene: NCgl1322     GI: 19552593     BI number: NCgl1322     GOG: COG0178     Description: excinuclease ATPase subuni             g           g  t           t  t            gc            Ta           A  |            Cg            Ta            Gc            At            Ta            Tg            Gc            Cg            Tg           C  a           G  a           A  a           G  |           T  |           G  |           A  |           G  |           A  |           A  |            Gc            Ta            Gc        ta GA        Gc       c  t T  G      T  t      g  g GC       A  t      t  t AT       T  g       at GC       A  |       gc A  G      A  |       cg AT        At        ta GT        Gt       t  | TA        Gc       g  | |  G       Cg       t  | GT       |  a       ta GC        At        cg TA        Cg        cg AT       A  |       at Tg        Gc        cg At        Gt        at                         attttttgaagcgacaaaaatcgattttgaagggcagttgagcaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0178 Excinuclease ATPase subunit ... can be seen here     ..................................................................................................................