Gene putatively regulated by attenuation in C_glutamicum

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:164 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-21.90 kcal/mol

                                                                        Nomenclature/Definitions

CACGAGCTTGAGGAAGCATCTTCTGATCTTCCAATCGAGCTGCGCGACAACCAGCGTT
TCAGCGGAAAGTAAttttcttacgacgctgcgtagttaaaaagcgtgactccccacattctcgggagtcacgcttttttgattctgcccg
cattcttggacgtgtgatgtacggcaggtgaattccgctttgctaggctgaatactaggcacggggtgccaaccggatggaaaaattccggaggctgaga
aaacacccgttgaacctgctctagctcgtactagcgaagggatggccttaacGTG

    NCgl1408


Gene: NCgl1408     GI: 19552679     BI number: NCgl1408     GOG: COG2145     Description: hydroxyethylthiazole kinas


           t
         a  t
         c  c
         a  t
         c  c
          cg
          cg
          cg
          ta
          cg
          at
          gc
          ta
          gc
          cg
          gc
          at
            tttttgattctgcccgcattcttggacgtgtgatgtacggcaggtgaattccgctttgctaggctgaatactaggcacggggtgccaaccggatggaaaaattccggaggctgagaaaacacccgttgaacctgctctagctcgtactagcgaagggatggccttaacGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Thiamine_Thi-box sequence ... can be seen here
    ..................................................................................................................