                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=3 nt.   Size=18 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-10.31 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAAAATAGACCTCGATGACACTTCCGGCAATGATCTTGCTGACGTTGAAATCGCAG
CAGTTTAAgcacgcgcacggaaagccactcgcccgatgactaggctaagaacttgtgcagtttttgtcgcgttccaatctgaacatgtcggcgg
tcaggttcaactgatccagttttctggcgaagtactctgatccagtgtttgaaaaaggaacattagtgccagtaacaagagcccagttgaattcaagcgg
gcagagacacatctggccctcaaaattttccttttactggagaccactGTG

    NCgl0096 Gene: NCgl0096     GI: 23308774     BI number: NCgl0096     GOG: COG0028     Description: thiamine pyrophosphate-requiring enzym   t g  g t  c ta cg at at gt at at t  | cg gt gc a  g t  c cg at gt |  c |  c |  a |  a |  t       cg |  c      t  g |  t       gc |  g       tg |  a      a  g |  a      c  |       tc |  c      a  |      t  a |  a       at       g  a |  t       gc        gc tg        ta        at at        cg        cg gc        tg        ta cg        at        gt cg        at        gc                         cagttttctggcgaagtactctgatccagtgtttgaaaaaggaacattagtgccagtaacaagagcccagttgaattcaagcgggcagagacacatctggccctcaaaattttccttttactggagaccactGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0028 Thiamine pyrophosphate-requiring enzymes [acetolactate synthase, pyruvate dehydrogenase (cytochrome), glyoxylate carboligase, phosphonopyruvate decarboxylase] ... can be seen here     ..................................................................................................................