                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-34.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-14.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATGGACATCAACCCAACCAAGGAAAAGAAGCTCACCAACATGCGTGCAGCTTCCGCA
GACACCACTGTCACCTTGGCTAAGGCTCGGTCTCTCTCCTTGGATGAGGCACTGGAGT
TCTGTGGCGTCGACGAGTGCGTCGAGGTTACCCCTGATGTTCTGCGCATCCGCAAGGT
CATCCTGAACGCTACTGAGCGTGGCCGTGCACGTTCCCGTGCGAAGAGCCTGAACAAG
TAAttctcttttagttaagagttgctctggcccgctgtgtcctctggacgcagcgggccagtagtattTTG

    NCgl1054 --- NCgl1055 --- NCgl1056 Gene: NCgl1054     GI: 23308825     BI number: NCgl1054     GOG: COG0747     Description: ABC-type transporter, periplasmic component Gene: NCgl1055     GI: 19552326     BI number: NCgl1055     GOG: COG2120     Description: hypothetical protein Gene: NCgl1056     GI: 19552327     BI number: NCgl1056     GOG: NOG13092     Description: hypothetical membrane protei TC T  C GC CG        ta AT       t  g CG       t  t        c GC       t  t      t  t TG       c  a       cg |  A       ta        cg |  A       cg        ta G  G       ta        gc C  A       tg        tg CG        At        gc GC        At        ta GC        Tg        cg T  |       Gc        gc GT       A  |       cg CG       A  |       cg |  A      C  |       cg G  A      A  |       gc A  C       At        gc G  A       Gc        ta TA       T  t       cg CG        Cg       |  t AT        Cg        ta TA        Gc        cg                         tattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here [S] COG2120 Uncharacterized proteins, LmbE homologs ... can be seen here     ..................................................................................................................