                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-10.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taatgtaagcatgagggatatacggttcgaatgggacgagaaaaaggccctctccaacaaaaagaagcatggtgtgtctttttctgaggcaaaaacggta
ttttatgacgagaatgcaaagatgatacatgacccagagcattcagaggaggaagacaggttcatcatcttaggtgtgagcgcagtagctcgtatcttgg
ttatttgtcattgttaccgtgaaaaggacaatgttattcgaatcatatcagctagaaaagcaacgaaaagagaggcaaatcaatacaagagggtaatgct
ATG

    CBU0007 Gene: CBU0007     GI: 29653371     BI number: CBU0007     GOG: NOG42361     Description: conserved hypothetical protei ga a  g cg ta tg a  g c  a g  a a  g g  a a  c c  a cg                  ag cg                 c  t at                 g  a gt                  cg t  c        t        gc a  |      t  a       at c  |      c  g       gc a  |       tg        tg ta        at        gt at        cg        ta gc       t  |       gt ta        at        gc at        cg        at gc        ta       t  t at        tg        tg at        gc        cg                         ttatttgtcattgttaccgtgaaaaggacaatgttattcgaatcatatcagctagaaaagcaacgaaaagagaggcaaatcaatacaagagggtaatgctATG     ..................................................................................................................