                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGAGGGTGAAATTACCGTCACCGTCCTCGAAGTACGCGGAAACCAAGTGCGCATGGG
TATCGATGCGCCTAAGCACATCGCGGTCCACCGAGAAGAGATTTACCAGCGCATTCAA
GAAGAAAAGCCAAAAGCGCCACCTATTCTTGAGGAAGTTGAATAAaccacttttgccgcttctggtt
cagatgaggctacctttttctgccattgaggcggcttttaattttatcttaagataaggaaatctttactgagatgcagtataatagctcccaactgagt
ctcttatgggagtatctATG

    CBU0023 Gene: CBU0023     GI: 29653387     BI number: CBU0023     GOG: -------     Description: hypothetical protei   A A  T G  A TA Ta Gc A  c A  a Gc Gt At Gt T  | T  | C  | T  | T  | A  |                  g T  |                t  c C  |                c  c C  |                t  a At                 t  t Cg         t       t  t C  c      g  t       tg Gc        gc        ta Cg        ta        cg Gc        cg        cg At        ta       a  c At       t  t      t  g A  c      c  g       cg At       g  a       gc Cg        cg        gt Cg        cg        at Gt        gc        gt                         taattttatcttaagataaggaaatctttactgagatgcagtataatagctcccaactgagtctcttatgggagtatctATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:95 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -6.70 kcal/mol Antiterminator: Size=46 nt.     Delta G= -3.87 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-12.12 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACGAGGGTGAAATTACCGTCACCGTCCTCGAAGTACGCGGAAACCAAGTGCGCATGGG TATCGATGCGCCTAAGCACATCGCGGTCCACCGAGAAGAGATTTACCAGCGCATTCAA GAAGAAAAGCCAAAAGCGCCACCTATTCTTGAGGAAGTTGAATAAaccacttttgccgcttctggtt cagatgaggctacctttttctgccattgaggcggcttttaattttatcttaagataaggaaatctttactgagatgcagtataatagctcccaactgagt ctcttatgggagtatctATG     CBU0023 Gene: CBU0023     GI: 29653387     BI number: CBU0023     GOG: -------     Description: hypothetical protei   A A  A C  A CG GC         A |  G      T  A |  C      A  a |  C      A  c A  A       Gc A  C       Ta A  C      T  | A  T       Gc G  A       At AT        At AT        Gt GC        Gt AT       A  g        t AT       G  c      g  t CG       T  c       gc TA       T  g       ta TG       C  c       cg A  G      T  t       ta C  A      T  t      t  t G  A      A  c      c  g CG       T  t      g  a GT        Cg        cg AT        Cg        cg CG        At        gc                         tacctttttctgccattgaggcggcttttaattttatcttaagataaggaaatctttactgagatgcagtataatagctcccaactgagtctcttatgggagtatctATG     ..................................................................................................................