                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.49 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -6.75 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCCGCAATGGCTTCATCGACACTATTATCGATGGCTTCATGAGCAAGGTGATTGGGG
CGAGAAGTATCCGTGTACATCCCAGGGCGGCGTTTCACGGGCTCTAAGCCACTCAACA
CTTCGATCGCTTCGGCAGTATAGCCTTTGCCAGTGGTTTTTTTCGTCGGCATtgctcttcg
gttcaatccacgttattgttcttaacttcatgatgggcaacccagattgtcatcccgcaaagcggaaaaggacaatttttataaattgagttgctggcga
caatgcaattgtacactaagcttATG

    kdtA Gene: kdtA     GI: 29653424     BI number: CBU0063     GOG: COG1519     Description: 3-deoxy-D-manno-octulosonic-acid transferas ta t  t gt         a cg       c  a at        gc |  t       gc |  c       gc c  t       ta c  t      a  g t  a      g  a        a a  a      t  t      a  a a  c       at        cg c  t       cg        gc t  t      t  t       cg t  c      t  c       cg g  a      c  a      |  a gt       a  t      |  a cg       a  c      c  a ta       t  c      t  a t  t      t  c      a  g cg       c  |       cg tg       t  |       ta cg        tg        gc gc        gc        ta ta        ta        ta Ta        ta        at                         ttttataaattgagttgctggcgacaatgcaattgtacactaagcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1519 3-deoxy-D-manno-octulosonic-acid transferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:142 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.30 kcal/mol Antiterminator: Size=20 nt.     Delta G= -3.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACCCGCAATGGCTTCATCGACACTATTATCGATGGCTTCATGAGCAAGGTGATTGGGG CGAGAAGTATCCGTGTACATCCCAGGGCGGCGTTTCACGGGCTCTAAGCCACTCAACA CTTCGATCGCTTCGGCAGTATAGCCTTTGCCAGTGGTTTTTTTCGTCGGCATtgctcttcg gttcaatccacgttattgttcttaacttcatgatgggcaacccagattgtcatcccgcaaagcggaaaaggacaatttttataaattgagttgctggcga caatgcaattgtacactaagcttATG     kdtA Gene: kdtA     GI: 29653424     BI number: CBU0063     GOG: COG1519     Description: 3-deoxy-D-manno-octulosonic-acid transferas            AG           T  C           A  C           T  T            GT            AT            CG   G        GC C  C       GC T  T      C  | AT       T  | GC        TA CG        CG TG        GT |  C       CG TA        TG CG        AT AT        GT             TTTTTCGTCGGCATtgctcttcggttcaatccacgttattgttcttaacttcatgatgggcaacccagattgtcatcccgcaaagcggaaaaggacaatttttataaattgagttgctggcgacaatgcaattgtacactaagcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1519 3-deoxy-D-manno-octulosonic-acid transferase ... can be seen here     ..................................................................................................................