                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:13 nt.    Distance to gene:153 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-23.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tagtaa-taacat. It has a score value of 63.59 and is shown in blue

tagtaatttcgcagtgatatgcttaacataagcacgtattgtccctctccccctcgaggagagggttaaggagagggtttttaaagaacctaactgctgc
ggttttttaccctctcctagcctctcccgcaggcgggaggggaatagcggaaggaggcattgaggatttatacaactcctttttagtgccatccaagttc
ttttttctgaaacactatcaaggttggggtcgatATG

    CBU0085 --- CBU0086 --- CBU0087 Gene: CBU0085     GI: 29653446     BI number: CBU0085     GOG: -------     Description: entericidin, putative Gene: CBU0086     GI: 29653447     BI number: CBU0086     GOG: COG3618     Description: 2-pyrone-4,6-dicarboxylic acid hydrolase, putative Gene: CBU0087     GI: 29653448     BI number: CBU0087     GOG: COG3083     Description: sulfatas            g          a  g          g  a           cg           ta           cg           cg           cg          |  t          |  t          |  a          |  a           cg           cg           ta           cg           ta           cg           cg           cg             tttttaaagaacctaactgctgcggttttttaccctctcctagcctctcccgcaggcgggaggggaatagcggaaggaggcattgaggatttatacaactcctttttagtgccatccaagttcttttttctgaaacactatcaaggttggggtcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3618 Predicted metal-dependent hydrolase of the TIM-barrel fold ... can be seen here [R] COG3083 Predicted hydrolase of alkaline phosphatase superfamily ... can be seen here     ..................................................................................................................