                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:174 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:41 nt. Size=22 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:    Distance from promoter:4 nt.    Size=49 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tttaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaatcatcgcttatcgcccagatttaataaataatgatataaaaagtagcccaagggctaaaaaacgtaaagcccatcgttcccgtggcttcggccg
tgagagttttgtattcttcaatactacagcagacagcctcacgggaggacgacggggtttaagtatttcactcttcaccactggtgggtaatgatagggg
gcccgttctatgcgcgcagcgcggaatgacgaagcctaaaattcaaatggcagtgacttgtgggaatgatagaggagacaaatcATG

    clpB --- CBU0095 Gene: clpB     GI: 29653454     BI number: CBU0094     GOG: COG0542     Description: clpB protein Gene: CBU0095     GI: 29653455     BI number: CBU0095     GOG: COG0530     Description: sodium/calcium antiporter family protei aa c  g cg cg gc at ta |  a |  a |  a |  a |  a |  c |  g g  t a  a a  a       tc        tc a  a      t  c      t  g a  g       gc        cg a  c       cg        gc t  c      t  t       gc a  c      a  |       tg ta       c  |       gt at        cg        cg gc        cg       c  a tg        gc        cg at        at        ta at        at        tg                         ttttgtattcttcaatactacagcagacagcctcacgggaggacgacggggtttaagtatttcactcttcaccactggtgggtaatgatagggggcccgttctatgcgcgcagcgcggaatgacgaagcctaaaattcaaatggcagtgacttgtgggaatgatagaggagacaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0542 ATPases with chaperone activity, ATP-binding subunit ... can be seen here [P] COG0530 Ca2+/Na+ antiporter ... can be seen here     ..................................................................................................................