Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=71 nt.     Delta G=-12.81 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGATTTTAAATGAaagggatcaggtactgaccctatcattacccacaatgggtaaagactaaaaacttaaacccaccaccccgcctccc
tcgtcatccccgcgcaggtgaggacccagcgtacggtgcgcagcgcgctaaaagcgcgcctggacttctgcgcggattacgaagtttaaaatggaaatcg
cgtccgtaccttaccttccattttataatcgtctcttaacgcagcgaatatttacgctacgttcttttttatagcataatacctggcagtgaaaaaacga
ggggttagtgGTG

    CBU0210 --- CBU0211


Gene: CBU0211     GI: 29653564     BI number: CBU0211     GOG: -------     Description: hypothetical protein
Gene: CBU0212     GI: 29653565     BI number: CBU0212     GOG: -------     Description: hypothetical protei


            g
          c  t
          c  a
          t  c
          g  c
          c  t
          g  t
          c  a
          t  c
          a  c
           at
           at
           gc
           gc
           ta
           at
           at
           at
           at
           ta
          t  t
          t  a
          g  a
          a  |
 gg        at
c  a       gc        at
g  t       cg       t  t
c  t       at       a  t
g  a      |  c      a  a
t  c      |  t       gc
 cg       |  c       cg
 ta       t  t       gc
 ta       t  t       at
 cg       a  a      c  a
 at       g  a       gc
 gt        gc        cg
 gt        cg        at
 ta        gc        at
                        cttttttatagcataatacctggcagtgaaaaaacgaggggttagtgGTG


    ..................................................................................................................