                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:178 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggacaaaaatcaatagcccgtatggagggcagaagacagaggacagaggacagaggacagaggacagaagacagaagacagaggacagtggttgtgtcg
ctatgcgacaactaaattttataaattaatgttggcgaagccacacaactctgttttcagtcctctgtcctctgtcttctggtaatcaaagattcagctc
ctacctcattacccctagcaaaaaagttaaaaggcgagaaattgcggacaagcagcaacttatatataatcacccgacaaccattcaaggtgggggtttt
ATG

    CBU0214 Gene: CBU0214     GI: 29653567     BI number: CBU0214     GOG: COG0670     Description: membrane protein, putativ ga g  c a  a g  g at cg a  g g  |        a at       t  t at        cg g  g       gc at        cg cg        ta at        gc gc        ta |  g      g  | a  c      t  | a  t       ta g  a       gc at        gt cg        ta             aattttataaattaatgttggcgaagccacacaactctgttttcagtcctctgtcctctgtcttctggtaatcaaagattcagctcctacctcattacccctagcaaaaaagttaaaaggcgagaaattgcggacaagcagcaacttatatataatcacccgacaaccattcaaggtgggggttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0670 Integral membrane protein, interacts with FtsH ... can be seen here     ..................................................................................................................