                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-14.12 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTGTGATATTATTGGCGATCGCTTCACAAACTGACAAGGGGCGAAGGGCTTGGGGTT
TTATTAAAAACGCGCGGACGGAGTTGCGCAAAGTAGTTTGGCCGACTCGCCAGGAGAC
GCTTCAAACAACGTTGGTTGTTATTGTGATGGTTGTAATTACGGCCCTCATTTTATGG
GGTCTTGATAGCTTCTTTATGTGGGCTATCGGGTGGATGGCTGGACAAAGAGGATAAt
aaaatctcgcgtccgaagaattattgttcttgttgatcgcgccgggggttttgaggagtttattaaagATG

    _v13 Gene: nusG     GI: 29653577     BI number: CBU0225     GOG: COG0250     Description: transcription antitermination protein Nus AC G  T C  C CG GC GC        TT TA       G  G TG        CG TG        AT G  A       AT A  G       CG TA        AT GC        AT A  G      A  A A  C      C  T A  T      T  T C  T      T  | G  C       CG        AT C  A       GT       A  T G  |       CG        TA TA       A  A       GC TA       G  |       TG GC       A  |       TG A  A      G  |       GC G  A      G  |       GC GC        AT       T  C CG        CG        AT AT        CG        GC GT        GT        TA                         TTTTATGGGGTCTTGATAGCTTCTTTATGTGGGCTATCGGGTGGATGGCTGGACAAAGAGGATAAtaaaatctcgcgtccgaagaattattgttcttgttgatcgcgccgggggttttgaggagtttattaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0250 Transcription antiterminator ... can be seen here     ..................................................................................................................