                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-17.12 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAAAGTGCTTTTTGAGCCTGGCGAAGTCGTTCGTGTGATTGAAGGTCCGTTCGCCGA
TTTCAATGGCGTGGTTGAAGACGTCAATTACGAAAAAAACCGTTTGCGAGTCTCGGTG
CTTATTTTTGGACGTTCGACGCCGGTCGAATTGGAATTTGGTCAGGTTGAGAAAAGTT
AGgagcacagagtaaatctgtgcgtttaaagtaaaatcttttggcgtttgcggccgagattttttaaaaacaattggggagctcattgaataacagatg
atgagcgattgaacccaggagaaaattATG

    secE --- nusG Gene: rplK     GI: 29653578     BI number: CBU0226     GOG: COG0080     Description: ribosomal protein L11 Gene: rplA     GI: 29653579     BI number: CBU0227     GOG: COG0081     Description: ribosomal protein L   a t  a g  a at gc at cg at cg gc a  g gt Gt At Ta Ta |  a G  g A  t A  a A  a A  a G  a        t At       t  g Gc       t  c T  t      g  g T  |       cg Gt        gc Gt        gc At        tg Cg        ta Tg        tg Gc        ta             ttttttaaaaacaattggggagctcattgaataacagatgatgagcgattgaacccaggagaaaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0080 Ribosomal protein L11 ... can be seen here [J] COG0081 Ribosomal protein L1 ... can be seen here     ..................................................................................................................