Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:140 nt.    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.90 kcal/mol
Antiterminator:    Distance from promoter:89 nt. Size=56 nt.     Delta G=-11.41 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGACA-TATAGT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGACACCGTATCCTCTAGCGATATAGTTAGCCGTACAAATGACGCCCCGCGAATGAG
CAGCCCCCCCTACAGCAACCGGTTTTTCGCGCAACTTAGGATTGTCGCGCATTTCAAT
CGCCACATAAAAGCAATCCATGTCAACATGAATGATTTTCCGAAGCTTTTTTGAGGTA
CTTTCTCGCACggggagcctctttttaccataaagtacaaaaagagctgtaaacaaacctagttatcgtccttaggataatgtttattttta
taccataatccaatacactcttgctATG

    CBU0279


Gene: CBU0279     GI: 29653631     BI number: CBU0279     GOG: COG1834     Description: conserved hypothetical protei


 CA
T  A
 GC
 TA
 AT
 CG
|  A
|  A
|  T
 CG
 TA
 AT
 AT
|  T
|  T
|  C
|  C
|  G
|  A       CA
|  A      G  C
 CG        Cg
 GC        Tg
 AT        Cg
 AT        Tg
 AT        Ta
 AT       T  |
T  T      C  |
 AT       A  |
 CG        Tg
A  A       Gc
 CG        Gc
 CG        At
 GT        Gc
            tttttaccataaagtacaaaaagagctgtaaacaaacctagttatcgtccttaggataatgtttatttttataccataatccaatacactcttgctATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG1834 N-Dimethylarginine dimethylaminohydrolase ... can be seen here

    ..................................................................................................................