                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtcccttagccgtagcccgtatggagtgaagcgaaatacgggaattattattattccgccgtattccacttcgcttcatacgcttactttctaaaaaact
taaaaccgtcgtcctcccgcgaggccgtctgctgtagtattgaagcatacaaaaccttcacggccgagtcgggagatccagaTTAGGGGGCTA
AAAAAACACCGATAGCGCTTTTCTTAGCGTTAGTGAATTGGATTTTTTTATTGAAAAA
GGCATCATAGAATGGTGAAAAAAGATAATCGATGCAACTAGGAGCCAAcGTG

    pfkA Gene: pfkA     GI: 29653691     BI number: CBU0341     GOG: COG0205     Description: 6-phosphofructokinas                      TC                     T  T ga                 T  T a  t                 TA gc        AC        CG gc       A  A       GC g  a      A  C       CG cg       A  C       GT ta       A  G       AT gT       A  A       TA aT        AT       |  G |  A       TA       |  T |  G       CG       |  G |  G       GC       |  A g  G      G  G      |  A cG        GC        AT cG        GT        GT gC        GT        CG gT        AT        CG                         ATTTTTTTATTGAAAAAGGCATCATAGAATGGTGAAAAAAGATAATCGATGCAACTAGGAGCCAAcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0205 6-phosphofructokinase ... can be seen here     ..................................................................................................................