                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTCATTGGACGAAATTAATTTTACGTTTGCTTTTTGCTAACGGGATCATGGGATTG
GCGATTGGTGCTTTTGCAGGAAGAGTTGATCATTGGCTGATGTGGTCAGTAATGGAGC
GCGTTTGGCATTTGGTAGTGGTTATCTTGTTGGGATTGCTAAGCTACGCAGCGGCTGT
GTGGATTTCAGGGTTGCGCCTGCGTGATCTTCGGCCCCCGGTTAACATTGATTGAcggg
gattattcggttagcctgtggtcctttttctgaaggatcgcgtttttgttcacttcatgtgattagtATG

    ribF Gene: ribF     GI: 29653738     BI number: CBU0391     GOG: COG0196     Description: riboflavin biosynthesis protein Rib CA A  T AT TG TA GT GT CG C  A C  | C  | C  | G  |       ta Gc       t  g Cg        gc        tc Tg        gc       t  t Tg       c  t       tg Cg       t  |       ta Ta        tg        ta At        at        cg Gt        tg        cg Ta        tg        ta Gt        at        gt C  t       gc        gc Gc        gc        tg Tg        gt        gc Cg        gt        tg                         tttttgttcacttcatgtgattagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0196 FAD synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -9.00 kcal/mol Antiterminator: Size=42 nt.     Delta G=-10.60 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G=-16.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCCTCATTGGACGAAATTAATTTTACGTTTGCTTTTTGCTAACGGGATCATGGGATTG GCGATTGGTGCTTTTGCAGGAAGAGTTGATCATTGGCTGATGTGGTCAGTAATGGAGC GCGTTTGGCATTTGGTAGTGGTTATCTTGTTGGGATTGCTAAGCTACGCAGCGGCTGT GTGGATTTCAGGGTTGCGCCTGCGTGATCTTCGGCCCCCGGTTAACATTGATTGAcggg gattattcggttagcctgtggtcctttttctgaaggatcgcgtttttgttcacttcatgtgattagtATG     ribF Gene: ribF     GI: 29653738     BI number: CBU0391     GOG: COG0196     Description: riboflavin biosynthesis protein Rib TG T  C G  G GC GC AT CG        CA |  C      A  T |  G       AT T  T       TG TG        TA TA        GT AT        GT GC        CG GT       C  A T  T      C  |       ta G  |      C  |      t  g T  |      C  |       gc GC       G  |       gc TG        Gc       c  t CG        Cg       t  | GC        Tg        tg GC        Tg        at |  C       Cg        tg C  C       Ta        tg G  C       At        at A  G       Gt        gc CG        Ta        gc GT        Gt        gt                         ttttctgaaggatcgcgtttttgttcacttcatgtgattagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0196 FAD synthase ... can be seen here     ..................................................................................................................