Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:159 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=79 nt.     Delta G=-12.49 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -8.84 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTTGTTTTTTTGAAAAACAAAAAAATTCGCTACCATCCGCCCTTTAGGGTCACAAC
AAGCGCCCAAGGCCCCCCGTATTTCATTAATCTCGCGCACATCACAAGTCAGCTGGCC
TTGGAGAAAGGTAGCTGCATTTTCTCCTTTAACAAGGATAAAACCGAAGGGATCGATT
GCAATCGTAATGGGTTGCATaagcttctgcttgtgagatggttgtgctcattataatcctattgctttttaaccgaaaagcatta
tcatgccagctccacgatttaatgattaaagattaaccaccATG

    CBU0432


Gene: CBU0432     GI: 29653777     BI number: CBU0432     GOG: COG0477     Description: major facilitator family transporte


           TA
          G  T
          C  T
          C  T
          C  C
          C  A
          C  T
          C  T
          G  A
          G  A
          A  T
          A  C
          C  T
          C  C
           CG
           GC
           CG
           GC
          |  A
          |  C
          |  A
          |  T
          |  C
          |  A
          |  C
          |  A
          |  A
 TT       A  G
T  A      A  T
 CG       C  C
 CG       A  A        A
 CG       A  G      G  G
 GT       C  C      G  A
C  C       AT        TA
C  A       CG        TA
T  C       TG        CG
A  A       GC        CG
C  A       GC       G  |
C  C       GT        GT
A  A       AT        TA
 TA        TG        CG
 CG        TG        GC
 GC        TA        AT
 CG        CG        CG
                        CATTTTCTCCTTTAACAAGGATAAAACCGAAGGGATCGATTGCAATCGTAATGGGTTGCATaagcttctgcttgtgagatggttgtgctcattataatcctattgctttttaaccgaaaagcattatcatgccagctccacgatttaatgattaaagattaaccaccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here

    ..................................................................................................................