Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGCATTGTCGTCGGTACCCGGCATCAGCCAAAAAACCGTTGCTCGTCTCATAAGAAA
CAATCCTCATCGCTTAGTGGTTAATCCGTAGgtgaaggataaccctctcccgcaagcgggagaggggagaagaaaat
ctatcgctcccctttggaaaaccccatcgcgcttgtctctggcgccagcgccagagatttctttctttgaatgctacttcacgcttgaataatctttctc
cggcctgttatcattttcctgttcatgacgttgatcaaattgagaactgcaggatgtgactttttATG

    rfe


Gene: rfe     GI: 29653873     BI number: CBU0533     GOG: COG0472     Description: undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferas


           ca
          c  g
           gc
  c        cg
t  t       gc
g  c       gc
t  t       ta
 tg        cg
 cg        ta
 gc        cg
 cg        ta
 gc        gt
            ttctttctttgaatgctacttcacgcttgaataatctttctccggcctgttatcattttcctgttcatgacgttgatcaaattgagaactgcaggatgtgactttttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0472 UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N-acetylglucosamine-1-phosphate transferase ... can be seen here

    ..................................................................................................................