                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.53 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCTCGTTATGTTTACGTTGGTGCCTTTATTGAAAAAACTAGCAGCCAATGACAAACA
GTTTGTTGACAAGCAAGACGTCGCCGAGCTGCTGAGCGATGATCAATTAGTGGAGTTA
AGTTAGctggcgataagaggctagctttttttatatcagcaatatctcctctctcccaagcgggagaggagaaagtcgtgatcgagatctttttta
actacgcccctttctggactgactttcttctctggcctgatttgggtagactacaaacactattagtcaggacgaatagcggctgctcATG

    CBU0540 Gene: CBU0540     GI: 29653880     BI number: CBU0540     GOG: COG1196     Description: SMC family protei TG T  A GC TA         A TA       A  T TG       C  T GC       T  A A  A      A  G C  A      G  T A  G      T  G A  A      A  G A  C      G  A CG        CG AT        GT GC        AT TG       G  A |  C       TA        aa A  C       CG       t  g A  G      |  T      a  a C  A       GT       g  g CG        TA        cg GC        CG        gc AT        Gc        gt CG        At        ta GC       G  |       cg AT        Cg        Gc TG        Cg        At                         ttttttatatcagcaatatctcctctctcccaagcgggagaggagaaagtcgtgatcgagatcttttttaactacgcccctttctggactgactttcttctctggcctgatttgggtagactacaaacactattagtcaggacgaatagcggctgctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG1196 Chromosome segregation ATPases ... can be seen here     ..................................................................................................................