                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:52 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=55 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATCCCCATTGCCACTGATTCCCCCAGGCGATTCCTTCTACACTGTCCATGGACAATT
GAGGCCGAATAAAAGCGGGAAGAAGTGTGAAGAATGCCATGTGGAACAGGCAAAACGC
CCAAAACCAAGGCGAAGTTTGCTCTAGAGAATCAGAAGCTGTAGGGACAGTGTTTTTC
ATaggtttgaattaggtatgataacataacctttcagcagcccgtatgaagcgaagcgaaatacgggattttattaaaatttaatctcccgtatttcgc
ttcatacgggctacaggaagcgcttgtTTG

    CBU0580 Gene: CBU0580     GI: 29653918     BI number: CBU0580     GOG: COG3394     Description: conserved hypothetical protei            ta           a  a            gc            ta            at           |  a GG        ta A  G       gc TA        gc GC        at TA       |  t CG       t  t GT       t  c A  G      a  a A  T      a  g G  |       gc         a A  |       ta       g  a C  |       tg        cg T  |      t  c       gc AT        gc       a  g AT        gc       a  a GT       |  g      g  a AT        at        ta GC        Ta        at |  A       At        ta AT        Cg        gc Ta        Ta        cg Cg        Ta        cg Tg        Tg        cg                         attttattaaaatttaatctcccgtatttcgcttcatacgggctacaggaagcgcttgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3394 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................