                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:74 nt.    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:39 nt. Size=47 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TAATTT. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAAATACGCTGATATTTTTTAATTTCAGCCATTTGCCTCGCAGACCAGGCGTGG
GTGCGATCGAATTCCGCCAGACATTTGTCTATTTCGCTGATGTAAGCCGCAGGGAATT
TCTGGGCATTTTTTTTCTTTATAAACATagaagaggctctgctacaattaatgcatgagattttacattctaaaacgaa
ATG

    CBU0586 --- CBU0587 Gene: CBU0586     GI: 29653924     BI number: CBU0586     GOG: COG0493,COG0543     Description: conserved hypothetical protein Gene: CBU0587     GI: 29653925     BI number: CBU0587     GOG: COG0607     Description: glpE protein, putativ   T A  T T  T C  C TG GC T  T TG TA AT CG AT |  A |  A G  G A  C        A C  C      A  T CG       G  T GC        GT |  A       GC |  G       AT CG        CG CG       G  | TA        CG TA        CG AT        GC             ATTTTTTTTCTTTATAAACATagaagaggctctgctacaattaatgcatgagattttacattctaaaacgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ER] COG0493 NADPH-dependent glutamate synthase beta chain and related oxidoreductases ... can be seen here [HC] COG0543 2-polyprenylphenol hydroxylase and related flavodoxin oxidoreductases ... can be seen here [P] COG0607 Rhodanese-related sulfurtransferase ... can be seen here     ..................................................................................................................