                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-11.65 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cttcgctcatacagctacggttagacgcacttcagagattaatttttggaaggaacaaataaaatctcggcataccttctctcatccggactctgaccgt
cggctctggaatttaaccagatctgtctcttaaaatagagactcgcgggcttatttcaaagaaacttaccgccggtggggacttccaccccgccctgaag
gcgcttttgtgggtccaatgtagcagaattgggttcttcaagcaaacatagacatcggactaaataaggactatatttagtctcatacaaggggctgacc
ATG

    CBU0645 --- CBU0644 Gene: CBU0645     GI: 29653983     BI number: CBU0645     GOG: NOG45891     Description: conserved hypothetical protein Gene: CBU0644     GI: 29653982     BI number: CBU0644     GOG: -------     Description: conserved domain protei            ag           a  a           a  a           c  a           t  c        t           t  t      t  c           t  t      c  c           a  a      a  a           t  c       gc           t  c       gc            cg        gc            gc        gc            gc        tg           g  g       gc            cg        gc aa        gt       |  c a  a       cg       |  t t  t       tg       |  g ta        cg       |  a cg       |  g      |  a ta       a  a       cg cg        gc        cg ta        at        gc gc        gt        cg                         cttttgtgggtccaatgtagcagaattgggttcttcaagcaaacatagacatcggactaaataaggactatatttagtctcatacaaggggctgaccATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:145 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G= -8.60 kcal/mol Antiterminator: Size=25 nt.     Delta G= -7.50 kcal/mol Anti-antiterminator:   Size=26 nt.     Delta G= -8.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cttcgctcatacagctacggttagacgcacttcagagattaatttttggaaggaacaaataaaatctcggcataccttctctcatccggactctgaccgt cggctctggaatttaaccagatctgtctcttaaaatagagactcgcgggcttatttcaaagaaacttaccgccggtggggacttccaccccgccctgaag gcgcttttgtgggtccaatgtagcagaattgggttcttcaagcaaacatagacatcggactaaataaggactatatttagtctcatacaaggggctgacc ATG     CBU0645 --- CBU0644 Gene: CBU0645     GI: 29653983     BI number: CBU0645     GOG: NOG45891     Description: conserved hypothetical protein Gene: CBU0644     GI: 29653982     BI number: CBU0644     GOG: -------     Description: conserved domain protei                      aa                     a  a                     t  t   c                  ta c  g        t        cg a  t      t  t       ta gc       a  a       cg tg       a  a       ta cg        gc        gc t  c       gc       t  t c  |       ta       c  c at        cg       t  g gc        ta       a  c gt       c  t      g  g cg        gc       a  | cg        gt        cg ta        cg        cg                         cttatttcaaagaaacttaccgccggtggggacttccaccccgccctgaaggcgcttttgtgggtccaatgtagcagaattgggttcttcaagcaaacatagacatcggactaaataaggactatatttagtctcatacaaggggctgaccATG     ..................................................................................................................