                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:183 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.60 kcal/mol
Antiterminator:    Distance from promoter:129 nt. Size=66 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:    Distance from promoter:102 nt.    Size=51 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TAAGTT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAATTTTACCATCTCCTCTAAGTTTGCACCGTCGGCGAATATTTTGACTTTTAA
TTCTTGTAAGTGGTCATTTTCCATcttgcgtcctttcagttgagaattaaatttggggtagtatactgcaggaattaatttg
tgccaacttaatgaagttcatatgagtgcagggatgcgattaactgagttatttaattgatttttttttttatgcggcatagaattgctgggtttctttt
aaaggctaaaaaggattatttATG

    CBU0676 --- CBU0677 --- CBU0678 --- CBU0679 --- CBU0680 --- CBU0681 --- CBU0682 Gene: CBU0676     GI: 29654014     BI number: CBU0676     GOG: -------     Description: NAD dependent epimerase/dehydratase Gene: CBU0677     GI: 29654015     BI number: CBU0677     GOG: COG0451     Description: NAD dependent epimerase/dehydratase family protein Gene: CBU0678     GI: 29654016     BI number: CBU0678     GOG: -------     Description: ADP-heptose synthase, putative Gene: CBU0679     GI: 29654017     BI number: CBU0679     GOG: -------     Description: oxidoreductase, Gfo/Idh/MocA family Gene: CBU0680     GI: 29654018     BI number: CBU0680     GOG: COG1004     Description: UDP-glucose/GDP-mannose dehydrogenase family protein Gene: CBU0681     GI: 29654019     BI number: CBU0681     GOG: COG0451     Description: conserved hypothetical protein Gene: CBU0682     GI: 29654020     BI number: CBU0682     GOG: COG0500     Description: conserved domain protei             g           a  t           g  t           t  a           c  t            at            at            ta            ta            at            gt   g        cg a  t      g  | a  t       ta gc        at ta        gt at        gt |  a       gt at       |  t tg       |  t ta       |  t cg       |  t at       |  t a  |      |  t c  |      |  t cg       |  a gc        at ta        cg g  g       gc        ga tg        tg       a  a tg       g  g      t  t ta       a  |       at at        gc        cg |  g       ta        gc a  c       at        gt tg        ta        cg ta       a  |      g  g at        cg        tg at        ta        at                         ttcttttaaaggctaaaaaggattatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MG] COG0451 Nucleoside-diphosphate-sugar epimerases ... can be seen here [M] COG1004 Predicted UDP-glucose 6-dehydrogenase ... can be seen here [MG] COG0451 Nucleoside-diphosphate-sugar epimerases ... can be seen here [QR] COG0500 SAM-dependent methyltransferases ... can be seen here     ..................................................................................................................