                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:153 nt.    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-20.90 kcal/mol
Antiterminator:    Distance from promoter:128 nt. Size=37 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:    Distance from promoter:84 nt.    Size=49 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-TAGTAT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATGAACGGATTATCTTCGACTAATAGTATAAGTGGTTTCTTTATTGGTTTTTTT
GTAATCATtgtgcagatgaggcgacagcatgcctaacactaaacatgatctctcatgtgtgataccatcgaaatgcatgtctgagggaagtgct
gggcgatactatcgtctcaaacctattttattttgggccagcgatgcttcaatcggcatgctggccttttttattatattgaatcacatttgacataaat
ggtacaatcagaaattcaccaaaactcttGTG

    CBU0761 --- CBU0762 Gene: CBU0761     GI: 29654093     BI number: CBU0761     GOG: -------     Description: hypothetical protein Gene: CBU0762     GI: 29654094     BI number: CBU0762     GOG: -------     Description: hypothetical protei   a g  g t  g cg ta g  a       tt tg       a  t at       t  t cg       c  a       aa gc       c  t      c  t t  t       at       t  c a  g       at        tg a  g       at        cg a  g       cg        gc gc        tg        ta cg        cg        at ta       |  c      g  | at       |  c       cg c  a      |  a       gc c  c       tg        at at        gc        cg ta        cg        cg at        ta        gc gc        at        gc tg        tg        gt                         tttttattatattgaatcacatttgacataaatggtacaatcagaaattcaccaaaactcttGTG     ..................................................................................................................