                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:1 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-16.80 kcal/mol
Antiterminator:    Distance from promoter:28 nt. Size=38 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtca-tatcgt. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcatgacgatcagtcgttttcttatcgtgacctcgaaaaatgtgctaatcgcttagctcactatctggaacgtcatgaagttcatcaaggagagatt
gtcgccctttatatgcggcgatctttcgatgttttaGTG

    CBU0787 --- CBU0788 Gene: CBU0787     GI: 29654115     BI number: CBU0787     GOG: COG1020     Description: peptide synthetase, putative Gene: CBU0788     GI: 29654116     BI number: CBU0788     GOG: COG3321     Description: polyketide synthase, putativ at c  g        t t  a      t  a g  a      t  t cg       c  a at       c  t at        cg gc        gc g  a       cg t  t       tg c  c       gc t  a       tg a  a       ta tg        at cg        gc a  a       at cg        gt ta        at cg        gc             gatgttttaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG1020 Non-ribosomal peptide synthetase modules and related proteins ... can be seen here [Q] COG3321 Polyketide synthase modules and related proteins ... can be seen here     ..................................................................................................................