                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:64 nt.    Distance to gene:157 nt.     Distance to run of Ts=2 nt.   Size=16 nt.     Delta G= -6.90 kcal/mol
Antiterminator:    Distance from promoter:24 nt. Size=45 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:7 nt.    Size=39 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCTA-TAAAAT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTAAATCGTCCGGGTCGTCCGTAAAATCAATTTGGCAGGTGCGTAACTGTTGAGA
ATCAACTTCGCCGCAGGCATCATAACCTTGTTTAAGTGCTCGAATCCGGGCAGAATTT
TTGTCGTAAGCGATGACCGGTTGGAGACGGCTAAAAGCAACAGCAACGGGAAGACCCA
CATAGCCAAGCCCAATAACAGCGATTTTCCTTGCGACGGCGTTCATgttgtgggattgtaacgcaa
gtgttctttctgcgaaagtaggaggtaaggactaacgATG

    ugd --- CBU0847 --- pgi --- galU Gene: ugd     GI: 29654174     BI number: CBU0846     GOG: COG1004     Description: UDP-glucose 6-dehydrogenase Gene: CBU0847     GI: 29654175     BI number: CBU0847     GOG: COG1028     Description: 3-oxoacyl-(acyl-carrier-protein) reductase Gene: pgi     GI: 29654176     BI number: CBU0848     GOG: COG0166     Description: glucose-6-phosphate isomerase Gene: galU     GI: 29654177     BI number: CBU0849     GOG: COG1210     Description: UTP-glucose-1-phosphate uridylyltransferas            CA           T  T           A  A           C  A   A        GC G  A       GC A  T      |  T GC        AT TA        CG TA        GT GC       C  T T  T      C  T C  T      G  | A  |      C  | A  |       TA T  |       TA GC        CG CG        AT |  C      A  G       AT GC       C  |      A  C TG       T  |       GC GC       A  |       CG G  A      A  |       TG A  G       GC        CG CG        AT        GC GC        GC        TA                         GAATTTTTGTCGTAAGCGATGACCGGTTGGAGACGGCTAAAAGCAACAGCAACGGGAAGACCCACATAGCCAAGCCCAATAACAGCGATTTTCCTTGCGACGGCGTTCATgttgtgggattgtaacgcaagtgttctttctgcgaaagtaggaggtaaggactaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1004 Predicted UDP-glucose 6-dehydrogenase ... can be seen here [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here [G] COG0166 Glucose-6-phosphate isomerase ... can be seen here [M] COG1210 UDP-glucose pyrophosphorylase ... can be seen here     ..................................................................................................................