                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -3.54 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTAATGCAGGAACATCACCCTGTTTTACCGCATCATGGACAATTGCTAACATCGTT
TCCGTTTCTTTAGATTCAGCAGAGCTTCGCCGCATcatgacaactccttgttttaacacattgaatgagcagat
ccttctattatccaacaacaatattaatgatttattaaccgtcaattatcgacaagcgttttccccgtatttcgcttcgctgcatacgggctattttcat
taaagggctggaaattctggattcatgctatcattagtaatcataaatgcttaacaaggtctgcgatcATG

    CBU0859 --- nadE Gene: CBU0859     GI: 29654186     BI number: CBU0859     GOG: COG3737     Description: conserved hypothetical protein Gene: nadE     GI: 29654185     BI number: CBU0858     GOG: COG0171,COG0388     Description: NAD+ synthetas cc c  g       cg c  t      t  c t  a      t  t t  t       cg t  t       gc t  t      c  | gc       t  | cg       t  | gc        ta at        at a  |       ta c  |       gc at        cg gc        cg cg        cg             ctattttcattaaagggctggaaattctggattcatgctatcattagtaatcataaatgcttaacaaggtctgcgatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3737 Uncharacterized conserved protein ... can be seen here [H] COG0171 NAD synthase ... can be seen here [R] COG0388 Predicted amidohydrolase ... can be seen here     ..................................................................................................................