                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:116 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttatc-tatact. It has a score value of 68.27 and is shown in blue

tttatcttttataaaaaaggtatatacttcaaattgtgaactgcgcagttttttgttttaacttcttttttaggagtacaacatggcagttaaaaagaaa
gatgccggcaaaaagaaaaaataagcccgcagattagttcatttagggaatgcctttgggcattcccttttttttacgtcttccattctcaccatccgat
atgataaaTTG

    CBU0913 --- CBU0912 Gene: CBU0913     GI: 29654236     BI number: CBU0913     GOG: COG2050     Description: conserved hypothetical protein Gene: CBU0912     GI: 29654235     BI number: CBU0912     GOG: COG2079     Description: 2-methylcitrate dehydratase, putativ           tt          t  g           cg           cg           gc           ta           at           at           gc           gc           gc           at             tttttttacgtcttccattctcaccatccgatatgataaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2050 Uncharacterized protein, possibly involved in aromatic compounds catabolism ... can be seen here [R] COG2079 Uncharacterized protein involved in propionate catabolism ... can be seen here     ..................................................................................................................