                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:98 nt.    Distance to gene:67 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -7.40 kcal/mol
Antiterminator:    Distance from promoter:65 nt. Size=44 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:    Distance from promoter:36 nt.    Size=39 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTTTA-TAAAAT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTTAAATAATAAACTCTCATAAAATTCATtataacatttggattttataatgacaatattattggaatttcgatt
tttttcctgaaaattggaaggttagaaccagacggggactgtatttttttgacgcttttgattgtgtcaactttatttcttatagtattataaaaagtga
aattcaatggaatgtctgatcaaaattagaccaattctagaggggctATG

    CBU0916 Gene: CBU0916     GI: 29654239     BI number: CBU0916     GOG: COG3568     Description: endonuclease/exonuclease/phosphatase famil             g           g  a            gc   c        gt t  c       cg t  t       at tg       g  a ta       a  t ta       c  t ta       c  t ta        at at        at gt        gt        tg cg        at       t  a tg        tg       t  t ta        ta       t  t ta        gc        cg a  g      |  g       gt a  g       gc        cg gt        at        at gt        at        gc ta        gt        ta tg        gt        ta                         ctttatttcttatagtattataaaaagtgaaattcaatggaatgtctgatcaaaattagaccaattctagaggggctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3568 Metal-dependent hydrolase ... can be seen here     ..................................................................................................................