                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:139 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.84 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCACGAATACAAACCAGGGTTTACTGCAAAAATGATGCTAAAGGACCTAAATTTAAG
CCAAGCCGCCGCGAGTGATGCCAAAGCAAATACCCCGCTTGGAAAGCGCGCAACAGAA
CTCTATCAACAATTCGTTGACTCCGATCACGGTGAAGTCGATTTTTCCGCTATTATCA
ACTTGTTAAAAGATAAATCTCAATAGttagataaaattaattcctacggcccctcttaaaagcagcaagttttcctacctg
tgctacatttaattttggaaattcaaaaaagggaagaaaaaagttATG

    CBU0925 --- CBU0924 Gene: CBU0925     GI: 29654246     BI number: CBU0925     GOG: COG2951     Description: lytic murein transglycosylase, putative Gene: CBU0924     GI: 29654245     BI number: CBU0924     GOG: COG4122     Description: O-methyltransferas            TC           C  T   A       A  A T  C       AT A  C       GC A  C      A  A A  C      C  A CG       A  C GC       A  A A  |      C  A AT       G  T       TC AT       C  T      A  A CG        GC        GC CG        CG        CG G  A       GT        CG T  A       AT       |  T A  A      |  G      |  G G  |      |  A      |  A TG       A  C       TA GC        AT        CG A  G       GC        AT GC        GC        GC CG        TG        TG GC        TA        TA                         TTTTTCCGCTATTATCAACTTGTTAAAAGATAAATCTCAATAGttagataaaattaattcctacggcccctcttaaaagcagcaagttttcctacctgtgctacatttaattttggaaattcaaaaaagggaagaaaaaagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2951 Membrane-bound lytic murein transglycosylase B ... can be seen here [R] COG4122 Predicted O-methyltransferase ... can be seen here     ..................................................................................................................