                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGTAGCTAATATTTTTTTGTCCTTTTGCCAAATAGTTCGGATCTAAAAAAACGCCT
TGATCGAGATTAATCGGAAAAGTTAGTTTGGGAAAATAAATGACTTTTCCTTTTTCCA
ATTGTTCGATTATTTCTGATTGAATTTCTTTTGTTGGAGAAGGGTTCCAAGCCGTAAT
ATCGTAAGAAATGATGGAAGACATaataaaatcctttgatcgcgagattaacatagcttgccatatctcattccctattgta
aatttgattcaacattctctcaattcctactcaggagaaaaactATG

    bcp --- CBU0962 Gene: bcp     GI: 29654279     BI number: CBU0963     GOG: COG1225     Description: bacterioferritin comigratory protein Gene: CBU0962     GI: 29654278     BI number: CBU0962     GOG: COG1028     Description: oxidoreductase, short chain dehydrogenase/reductase famil            TT           A  A           G  A            AT            GC            CG AA        TG A  T      A  A C  A      G  A       AA CG        TA       G  A GT        TA       G  A T  T       CG        GT T  C      |  T       TA T  |      C  T       TA T  |      G  A       TA CG        CG       G  | CG        AT        AT TA        AT        TG GT        AT        TA T  C      A  G       GC T  T      A  |       AT TA       A  |       AT TA       A  |       AT TA        TG        AT TA        CG        GC TA        TA        GC                         TTTTTCCAATTGTTCGATTATTTCTGATTGAATTTCTTTTGTTGGAGAAGGGTTCCAAGCCGTAATATCGTAAGAAATGATGGAAGACATaataaaatcctttgatcgcgagattaacatagcttgccatatctcattccctattgtaaatttgattcaacattctctcaattcctactcaggagaaaaactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1225 Peroxiredoxin ... can be seen here [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................