                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:109 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -9.80 kcal/mol
Antiterminator:    Distance from promoter:53 nt. Size=40 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:    Distance from promoter:13 nt.    Size=48 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcaaca-tatcat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcaacactcccaccaacgctatgctatcatatcgaacaatttaccgaagttgttgtttcttctgaggagcggtagagtgtttaatttctggcgcagcggt
ttatcttcactccgaaaggaaatcactatcgtgattatccttaaattatttgtgcttgctttaatttggtatttttgtttttctgaccctctatccaagc
acttaacctcgcgcctcatgcaacaacatattttaaattatcccaacaacaaggagtcgtcATG

    cydA --- 2 --- cydB Gene: cydA-2     GI: 29654281     BI number: CBU0965     GOG: COG1271     Description: cytochrome d ubiquinol oxidase, subunit I Gene: cydB     GI: 29654282     BI number: CBU0966     GOG: COG1294     Description: cytochrome d ubiquinol oxidase, subunit II Gene: CBU0967     GI: 29654283     BI number: CBU0967     GOG: -------     Description: lipoprotein, putativ   g g  a a  g gc tg         a cg       t  t t  t      t  c ta       t  t cg        gt ta        gc tg       c  a t  t       gc        at g  g       at       t  c t  t      c  c       cg t  t       gc        at gt        cg        cg ta       |  a       ta ta       g  a       at gt       g  a       at at        tg       |  a at        cg        at gc        ta        gc |  t       ta        gc cg        ta        at cg        at        at                         aaattatttgtgcttgctttaatttggtatttttgtttttctgaccctctatccaagcacttaacctcgcgcctcatgcaacaacatattttaaattatcccaacaacaaggagtcgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1271 Cytochrome bd-type quinol oxidase, subunit 1 ... can be seen here [C] COG1294 Cytochrome bd-type quinol oxidase, subunit 2 ... can be seen here     ..................................................................................................................