                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-16.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCACCATGGCCGCGATGAAAGAAATCGGCCTTGCCCATAACAAGGTCAACATCCACG
GCGGCGCCTGCGCCTTAGGCCATCCCATCGGCGCATCCGGTGCACGTATTTTGGTAAC
CTTGTTATACGCTTTACAAAAAAATAATTTACAACGCGGCATCGCTTCTCTGTGCATC
GGCGGCGGCGAAGCCACAGCGATTGCAATTGAAAGGGGATTTTAAacgctctccaatcgcgtagccc
gtatgaagcgaagcgaaatacgggtgacttcatacgagttacaaaaggaaatcttaaaaATG

    CBU0975 --- CBU0976 --- CBU0977 --- CBU0978 Gene: CBU0975     GI: 29654291     BI number: CBU0975     GOG: COG4799     Description: acyl CoA biotin-dependant carboxyltransferase Gene: CBU0976     GI: 29654292     BI number: CBU0976     GOG: COG1024     Description: enoyl-CoA hydratase/isomerase family protein Gene: CBU0977     GI: 29654293     BI number: CBU0977     GOG: COG4770     Description: biotin carboxylase/biotin carboxyl carrier protein Gene: CBU0978     GI: 29654294     BI number: CBU0978     GOG: -------     Description: hypothetical protei   A C  T C  A C  A GC TA TA CG CG GT GC                  CC C  A                C  A T  A                T  T A  C                A  C A  A                 CG AT                  CG GC        CT        GC A  |      C  G      |  G A  |       GC       |  C A  |       CG       G  A GC        GC       A  T TA        GC       T  C A  C      |  T      T  C G  G      |  T       CG CG       |  A       CG GC       |  G       GT CG        CG        CG CG        GC        GC GC        GC        TA                         CGTATTTTGGTAACCTTGTTATACGCTTTACAAAAAAATAATTTACAACGCGGCATCGCTTCTCTGTGCATCGGCGGCGGCGAAGCCACAGCGATTGCAATTGAAAGGGGATTTTAAacgctctccaatcgcgtagcccgtatgaagcgaagcgaaatacgggtgacttcatacgagttacaaaaggaaatcttaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG4799 Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) ... can be seen here [I] COG1024 Enoyl-CoA hydratase/carnithine racemase ... can be seen here [I] COG4770 Acetyl/propionyl-CoA carboxylase, alpha subunit ... can be seen here     ..................................................................................................................