                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.63 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATACCCTTTGCTTTTATCGGCGGTGATGGGAATCTCATATTTTTTGAGTTTTTGGAC
GGTTTTCCACACCGCCGTTCGGCTGATATTCAAGGCCTGGCCGATGGCGGTTCCGGGG
TGGAAGCGCCTGTCATTGAGAAGCGCTACGATTTGAGCGAGATGATTTTGAGAATTTT
TCATggttgggaaaccagatctttgtaaagtagcctgtatcgctgcgcttcatacgggttacttctatttttctacagcgctaaatggtacactata
aagcgtttttttagtatagttaaccccttATG

    CBU1001 --- CBU1000 --- CBU0999 --- purA Gene: CBU1001     GI: 29654316     BI number: CBU1001     GOG: COG4591     Description: lipoprotein ABC transporter, permease protein, putative Gene: CBU1000     GI: 29654315     BI number: CBU1000     GOG: COG1136     Description: lipoprotein ABC transporter, ATP-binding protein LolD Gene: CBU0999     GI: 29654314     BI number: CBU0999     GOG: COG2262     Description: GTP-binding protein Gene: purA     GI: 29654313     BI number: CBU0998     GOG: COG0104     Description: adenylosuccinate synthetas            ac           t  t   g       t  t t  c       gc cg        gt gc       |  a |  t      |  t       ac |  t      |  t      t  a c  c      g  t       gc ta       c  t       gt at       a  t       ta ta       t  c       at gc       a  t      a  a tg       c  a      a  a cg       t  c       ta cg        ta        cg gt        cg        gc at        gc        cg ta        cg        gt gc        gc        at                         tttttagtatagttaaccccttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4591 ABC-type transport system, involved in lipoprotein release, permease component ... can be seen here [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here [R] COG2262 GTPases ... can be seen here [F] COG0104 Adenylosuccinate synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:52 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-13.90 kcal/mol Antiterminator: Size=17 nt.     Delta G= -4.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GATACCCTTTGCTTTTATCGGCGGTGATGGGAATCTCATATTTTTTGAGTTTTTGGAC GGTTTTCCACACCGCCGTTCGGCTGATATTCAAGGCCTGGCCGATGGCGGTTCCGGGG TGGAAGCGCCTGTCATTGAGAAGCGCTACGATTTGAGCGAGATGATTTTGAGAATTTT TCATggttgggaaaccagatctttgtaaagtagcctgtatcgctgcgcttcatacgggttacttctatttttctacagcgctaaatggtacactata aagcgtttttttagtatagttaaccccttATG     CBU1001 --- CBU1000 --- CBU0999 --- purA Gene: CBU1001     GI: 29654316     BI number: CBU1001     GOG: COG4591     Description: lipoprotein ABC transporter, permease protein, putative Gene: CBU1000     GI: 29654315     BI number: CBU1000     GOG: COG1136     Description: lipoprotein ABC transporter, ATP-binding protein LolD Gene: CBU0999     GI: 29654314     BI number: CBU0999     GOG: COG2262     Description: GTP-binding protein Gene: purA     GI: 29654313     BI number: CBU0998     GOG: COG0104     Description: adenylosuccinate synthetas             g           t  c            cg            gc           |  t           |  t           c  c            ta            at            ta   t        gc g  a       tg t  t       cg c  c       cg cg        gt gc        at at        ta tg        gc gc        at             tctatttttctacagcgctaaatggtacactataaagcgtttttttagtatagttaaccccttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4591 ABC-type transport system, involved in lipoprotein release, permease component ... can be seen here [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here [R] COG2262 GTPases ... can be seen here [F] COG0104 Adenylosuccinate synthase ... can be seen here     ..................................................................................................................