Gene putatively regulated by attenuation in C_burnetii
Characteristics of the secondary structures
Terminator: Distance to gene:141 nt. Distance to run of Ts=0 nt. Size=34 nt. Delta G=-10.40 kcal/mol
Antiterminator: Size=41 nt. Delta G= -8.80 kcal/mol
Anti-antiterminator: Size=47 nt. Delta G=-10.62 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
AGactagcgtaactaaccaagccaccatacggtaaccgttcggttacgtggactgtgtaaagtaactatcgctcaagggaggattgctgtcaatactgt
ccagttccttacgtgacttttgcgtgactgagtgcgcattagtgctcatttgtacgtgttttcagggagcgtccggagctataaaatttatataatcaat
aagttagattttatctccgagacttaaaatccctcgggagttaaatctcgtgtcggttcaagttcggccccaggcaccatttttaaatcagtaggttaaa
gGTG
CBU1016
Gene: CBU1016 GI: 29654330 BI number: CBU1016 GOG: ------- Description: hypothetical protei
c
t a
g a
t t
c a t
g c c t
t t at
tg gt at
at tg c t
gc gc g a
gc cg cg
| a at gt
| g tg tg
at ta gc
gt c c at
gc c t gc
gc tg ta
at ta | t
at g g | t
c a at c t
t c cg a g
cg c c gt
gt tg ta
cg gc gc
ta ta cg
tgttttcagggagcgtccggagctataaaatttatataatcaataagttagattttatctccgagacttaaaatccctcgggagttaaatctcgtgtcggttcaagttcggccccaggcaccatttttaaatcagtaggttaaagGTG
..................................................................................................................