Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-17.40 kcal/mol
Anti-antiterminator:   Size=76 nt.     Delta G=-15.82 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTTCAGTTGGTGGCGTTGCCCGGCCAAATAGACGGTTACTTTCAATCCGTTTTCGTA
AGCCAAGCGCGCAAGCACTAGCCCGTCGCCCCCGTTATTCCCCTTCCCACAACATACG
GTAATTTCTTGAGCCTCGGGCCATCGCGCTAGAAGCGCTTTAAAAGCGGCCTCTCCGG
CGCGACACATTAATTCATATTCACTAATGCCCGATTCAACTGCCAAGCGCTCTAATTC
GCGAATTTGGCGGTTTTGGTACAATACTGTCATtcttttttctctatcattcttctaagcgcagtcgtTTG

    CBU1089


Gene: CBU1089     GI: 29654396     BI number: CBU1089     GOG: -------     Description: hypothetical protei


 CA
T  T
 TA
 AT
 AT
T  C
T  A
A  C
C  T
A  A
C  A
A  |
 GT
 CG
 GC
C  |       AA
 GC       T  T
 GC       C  T
 CG       T  C
C  A       CG
T  T       GC
C  T       CG
T  C      |  A
C  A      |  A
C  A      G  T
 GC        AT
 GT        AT
 CG        CG
 GC        CG         T
A  C       GC       G  A
A  |       TG        GC
A  |       CG        TA
A  |       AT        TA
T  |       AT       T  T
 TA       C  |       TA
 TA       T  |       GC
 CG       T  |       GT
 GC        AT        CG
 CG        GT        GT
 GC        CG        GC
 AT        CG        TA
                        TtcttttttctctatcattcttctaagcgcagtcgtTTG


    ..................................................................................................................