                                                                        Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:150 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-32.82 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCATTGCAGAGAATTATGCAACGGCCTAGTAATCAGCCCAAAGCAAGTATTTAGcaag
tagcccgtatggagcgcagcggaatacgggaaacgtgaaaaggaattcccgtattccgctgcgctccatacgggctactttttgtttttaaaaaaaaaca
ctattaatgaatccgctattgcgcgtgaagttggacaattttcttggagattccacttgagaggtgagtatagatatcccgaacaccacgtccaatatcg
attttgcatttaagatgctcagcggatatactttatgctcaATG

    CBU1112 --- CBU1111 Gene: CBU1112     GI: 29654419     BI number: CBU1112     GOG: COG2827     Description: conserved hypothetical protein Gene: CBU1111     GI: 29654418     BI number: CBU1111     GOG: COG2821     Description: membrane-bound lytic murein transglycosylase family protei             a           a  a           g  a           t  g           g  g           c  a           a  a   c        at g  a       at cg        gc gc        gc a  g       gc         g g  g       cg       t  c g  a       at        cg ta        ta        gc at        at       c  t ta        at       c  c gc        gc       t  c cg        gc        ta cg        cg        at cg        gc        ta g  a       at        gc a  a       cg        cg ta        gc        cg gc        cg        cg                         ctactttttgtttttaaaaaaaaacactattaatgaatccgctattgcgcgtgaagttggacaattttcttggagattccacttgagaggtgagtatagatatcccgaacaccacgtccaatatcgattttgcatttaagatgctcagcggatatactttatgctcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2827 Predicted endonuclease containing a URI domain ... can be seen here [M] COG2821 Membrane-bound lytic murein transglycosylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_burnetii                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:157 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -8.60 kcal/mol Antiterminator: Size=49 nt.     Delta G=-32.82 kcal/mol Anti-antiterminator:   Size=35 nt.     Delta G=-12.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGCATTGCAGAGAATTATGCAACGGCCTAGTAATCAGCCCAAAGCAAGTATTTAGcaag tagcccgtatggagcgcagcggaatacgggaaacgtgaaaaggaattcccgtattccgctgcgctccatacgggctactttttgtttttaaaaaaaaaca ctattaatgaatccgctattgcgcgtgaagttggacaattttcttggagattccacttgagaggtgagtatagatatcccgaacaccacgtccaatatcg attttgcatttaagatgctcagcggatatactttatgctcaATG     CBU1112 --- CBU1111 Gene: CBU1112     GI: 29654419     BI number: CBU1112     GOG: COG2827     Description: conserved hypothetical protein Gene: CBU1111     GI: 29654418     BI number: CBU1111     GOG: COG2821     Description: membrane-bound lytic murein transglycosylase family protei             a           g  a           t  a           g  a           c  g           a  g           a  a   c        aa g  a       gt cg        gt gc        gc a  g       cc         g g  g       ac       t  c g  a       tg        cg ta        at        gc at        aa       c  t ta        gt       c  c gc        gt       t  c cg        cc        ta cg        gc        at cg        ag        ta g  a       cc        gc a  a       gt        cg ta        cg        cg gc        gc        cg                         ctactttttgtttttaaaaaaaaacactattaatgaatccgctattgcgcgtgaagttggacaattttcttggagattccacttgagaggtgagtatagatatcccgaacaccacgtccaatatcgattttgcatttaagatgctcagcggatatactttatgctcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2827 Predicted endonuclease containing a URI domain ... can be seen here [M] COG2821 Membrane-bound lytic murein transglycosylase ... can be seen here     ..................................................................................................................