Gene putatively regulated by attenuation in C_burnetii

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=63 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTGTCGTCCCTTTTGGGGGTGGCATCGGTAATTTCCTCAACACctcagcatcatcgggattgttt
tgccgctgaatgaggtaattattcgtgttattcagacctgccccaagagcgcctcatcgccttttcgcaggatatcggagagcgactgtgtggagagaac
ggcatggacatccgcaaggtgctatttatttccgattaatttttggcccgattgccgtaaatttagtcttttttttgatcaaaaatagtgtagcattgtc
agtctagcaataatttcttggagatatagccctATG

    CBU1140


Gene: CBU1140     GI: 29654447     BI number: CBU1140     GOG: -------     Description: hypothetical protei


 tc
c  a
c  t
 gc
 cg
 gc
a  |
 gc
 at
 at
c  t
c  t
c  c
 cg         a
 gc       g  g
 ta       a  a
 cg       g  a
 cg        gc
|  a       tg
|  t      |  g
|  a       gc
 at        ta
 gc        gt
a  |       tg        ca
 cg        cg       g  a
 tg       a  a       cg
 ta       g  c       cg
a  g      c  a      t  |
t  a      g  |       at
t  |      a  |       cg
g  |      g  |      a  |
 tg        at        gc
 gc        gc        gt
 cg        gc        ta
 ta        cg        at
                        ttatttccgattaatttttggcccgattgccgtaaatttagtcttttttttgatcaaaaatagtgtagcattgtcagtctagcaataatttcttggagatatagccctATG
    ..................................................................................................................